Review



universal pcr reverse primer  (Sangon Biotech)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Sangon Biotech universal pcr reverse primer
    <t>MiR-652-3p</t> is upregulated in hyoxic BMSCs-derived exosome and can be transferred to HCC cells. ( A ) Transmission electron microscopy (TMB) showed the representative image of BMSCs or hypo-BMSCs derived exosome. ( B ) The particle diameter of the purified exosomes was showed in histogram. ( C ) Exosomal markers were detected by West blotting in BMSCs derived exosome and BMSCs cells. ( D ) Expression of miR-652-3p was detected in exosome derived from BMSCs under different conditions using <t>qRT-PCR.</t> Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01, compared with the indicated controls. ( E ) Expression of miR-652-3p was detected in HepG2 and SMMC-7721 cells after co-culturing with exosome derived from BMSCs under different conditions. Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05; ** P < 0.01, compared with the indicated controls.
    Universal Pcr Reverse Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/universal+pcr+reverse+primer/mirna+first+strand+cdna+synthesis+kit/pmc10713425-2-4-11
    Average 90 stars, based on 1 article reviews
    universal pcr reverse primer - by Bioz Stars, 2026-09
    90/100 stars

    Images

    1) Product Images from "Hypoxic BMSC-derived exosomal miR-652-3p promotes proliferation and metastasis of hepatocarcinoma cancer cells via targeting TNRC6A"

    Article Title: Hypoxic BMSC-derived exosomal miR-652-3p promotes proliferation and metastasis of hepatocarcinoma cancer cells via targeting TNRC6A

    Journal: Aging (Albany NY)

    doi: 10.18632/aging.205025

    MiR-652-3p is upregulated in hyoxic BMSCs-derived exosome and can be transferred to HCC cells. ( A ) Transmission electron microscopy (TMB) showed the representative image of BMSCs or hypo-BMSCs derived exosome. ( B ) The particle diameter of the purified exosomes was showed in histogram. ( C ) Exosomal markers were detected by West blotting in BMSCs derived exosome and BMSCs cells. ( D ) Expression of miR-652-3p was detected in exosome derived from BMSCs under different conditions using qRT-PCR. Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01, compared with the indicated controls. ( E ) Expression of miR-652-3p was detected in HepG2 and SMMC-7721 cells after co-culturing with exosome derived from BMSCs under different conditions. Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05; ** P < 0.01, compared with the indicated controls.
    Figure Legend Snippet: MiR-652-3p is upregulated in hyoxic BMSCs-derived exosome and can be transferred to HCC cells. ( A ) Transmission electron microscopy (TMB) showed the representative image of BMSCs or hypo-BMSCs derived exosome. ( B ) The particle diameter of the purified exosomes was showed in histogram. ( C ) Exosomal markers were detected by West blotting in BMSCs derived exosome and BMSCs cells. ( D ) Expression of miR-652-3p was detected in exosome derived from BMSCs under different conditions using qRT-PCR. Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01, compared with the indicated controls. ( E ) Expression of miR-652-3p was detected in HepG2 and SMMC-7721 cells after co-culturing with exosome derived from BMSCs under different conditions. Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05; ** P < 0.01, compared with the indicated controls.

    Techniques Used: Derivative Assay, Transmission Assay, Electron Microscopy, Purification, Expressing, Quantitative RT-PCR

    TNRC6A is a direct target of miR-652-3p in human HCC cells. ( A ) The underlying targets of miR-652-3p were predicted using TargetScan and miRDB databases. ( B ) Expression of target genes in HepG2 cells determined by qRT-PCR after transfecting with miR-652-3p mimic. ( C ) Scheme and sequence of the intact miR-652-3p, TNRC6A (Wt) and its mutant (Mut). Computer prediction of miR-652-3p binding sites in the 3’UTR of human TNRC6A gene. ( D ) SMMC-7721 cells were co-transfected with miR-652-3p and WT or MUT 3’UTR of TNRC6A. Data were presented as the mean ± SD, and analyzed with Student’s t-test. ** < 0.01; compared with the indicated NC mimic controls. ( E ) Protein level of TNRC6A was detected by WB in HepG2 and SMMC-7721 cells transfected with NC mimic and miR-652-3p. GAPDH was also detected as a loading control. Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01.
    Figure Legend Snippet: TNRC6A is a direct target of miR-652-3p in human HCC cells. ( A ) The underlying targets of miR-652-3p were predicted using TargetScan and miRDB databases. ( B ) Expression of target genes in HepG2 cells determined by qRT-PCR after transfecting with miR-652-3p mimic. ( C ) Scheme and sequence of the intact miR-652-3p, TNRC6A (Wt) and its mutant (Mut). Computer prediction of miR-652-3p binding sites in the 3’UTR of human TNRC6A gene. ( D ) SMMC-7721 cells were co-transfected with miR-652-3p and WT or MUT 3’UTR of TNRC6A. Data were presented as the mean ± SD, and analyzed with Student’s t-test. ** < 0.01; compared with the indicated NC mimic controls. ( E ) Protein level of TNRC6A was detected by WB in HepG2 and SMMC-7721 cells transfected with NC mimic and miR-652-3p. GAPDH was also detected as a loading control. Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01.

    Techniques Used: Expressing, Quantitative RT-PCR, Sequencing, Mutagenesis, Binding Assay, Transfection, Control

    Overexpression of miR-652-3p aborted the inhibitive effects of TNRC6A on the proliferation and metastasis of HCC cells. ( A ) The expression of miR-652-3p inHepG2 and SMMC-7721 cells determined by qRT-PCR, Cells were treated with four different means: pcDNA3.1 group, pcDNA3.1-TNRC6A group, co-transfection pcDNA3.1-TNRC6A and NC mimics and co-transfection pcDNA3.1-TNRC6A and miR-652-3p mimic group. Data were presented as the mean ± SD, and analyzed with Student’s t-test *** P < 0.001 ( B ) The mRNA expression of TNRC6A in HepG2 and SMMC-7721 cells determined by qRT-PCR. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01. ( C ) The protein expression of TNRC6A in HepG2 and SMMC-7721 cells determined by WB. Histogram show the protein expression of TNRC6A in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; **P < 0.01, ***P < 0.001. ( D ) Proliferation of HepG2 and SMMC-7721 cells determined by CCK-8 after treating with different ways, Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05 *** P < 0.001. ( E ) Colony formation assay of HepG2 and SMMC-7721 cells after treating with different ways ( F ) Histogram show the amount of colony in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01 *** P < 0.001. ( G ) Histogram show the distance of cellular migratory in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01. ( H ) Migration of HepG2 and SMMC-7721 cells determined by wound healing. ( I ) Invasion of HepG2 and SMMC-7721 cells determined by transwell. Cells that invaded to the bottom surface were stained with crystal violet and observed by light microscopy (magnification, 100×). Histogram show the capability of cellular invasion in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01 *** P < 0.001.
    Figure Legend Snippet: Overexpression of miR-652-3p aborted the inhibitive effects of TNRC6A on the proliferation and metastasis of HCC cells. ( A ) The expression of miR-652-3p inHepG2 and SMMC-7721 cells determined by qRT-PCR, Cells were treated with four different means: pcDNA3.1 group, pcDNA3.1-TNRC6A group, co-transfection pcDNA3.1-TNRC6A and NC mimics and co-transfection pcDNA3.1-TNRC6A and miR-652-3p mimic group. Data were presented as the mean ± SD, and analyzed with Student’s t-test *** P < 0.001 ( B ) The mRNA expression of TNRC6A in HepG2 and SMMC-7721 cells determined by qRT-PCR. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01. ( C ) The protein expression of TNRC6A in HepG2 and SMMC-7721 cells determined by WB. Histogram show the protein expression of TNRC6A in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; **P < 0.01, ***P < 0.001. ( D ) Proliferation of HepG2 and SMMC-7721 cells determined by CCK-8 after treating with different ways, Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05 *** P < 0.001. ( E ) Colony formation assay of HepG2 and SMMC-7721 cells after treating with different ways ( F ) Histogram show the amount of colony in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01 *** P < 0.001. ( G ) Histogram show the distance of cellular migratory in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01. ( H ) Migration of HepG2 and SMMC-7721 cells determined by wound healing. ( I ) Invasion of HepG2 and SMMC-7721 cells determined by transwell. Cells that invaded to the bottom surface were stained with crystal violet and observed by light microscopy (magnification, 100×). Histogram show the capability of cellular invasion in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01 *** P < 0.001.

    Techniques Used: Over Expression, Expressing, Quantitative RT-PCR, Cotransfection, CCK-8 Assay, Colony Assay, Migration, Staining, Light Microscopy

    Primers for qRT-PCR.
    Figure Legend Snippet: Primers for qRT-PCR.

    Techniques Used:

    Related Articles

    Polymerase Chain Reaction:

    Article Title: MicroRNA-598 inhibition ameliorates LPS-induced acute lung injury in mice through upregulating Ebf1 expression
    Article Snippet: .. The specific primer sequences are listed below: miR-598, forward 5ʹ-GCGGUGAUGCCGAUGGUGCGAGC-3ʹ and reverse, universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.), U6, forward 5ʹ-CTCGCTTCGGCAGCACA-3ʹ and reverse 5ʹ-AACGCTTCACGAATTTGCGT-3ʹ, Ebf1, forward 5ʹ-AGATTGAGAGGACGGCCTTTGT-3ʹ and reverse 5ʹ-TCTGTCCGTATCCCATTGCTG-3ʹ, and β-actin, forward 5ʹ-CGTGGGCCGCCCTAGGCACCA-3ʹ and reverse 5ʹ-TTGGCCTTAGGGTTCAGGGGG-3ʹ. .. Cultured cells or lung tissues were lysed in radioimmunoprecipitation assay (RIPA) buffer with proteinase inhibitor (Beyotime, China).

    Article Title: Palmitic acid inhibits vascular smooth muscle cell switch to synthetic phenotype via upregulation of miR-22 expression
    Article Snippet: .. R: Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.) miR-23b .. R: Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.) miR-125b

    Article Title: Palmitic acid inhibits vascular smooth muscle cell switch to synthetic phenotype via upregulation of miR-22 expression
    Article Snippet: R: Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.) miR-23b .. R: Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.) miR-125b .. R: Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.) NET1

    Article Title: MicroRNA-598 inhibition ameliorates LPS-induced acute lung injury in mice through upregulating Ebf1 expression
    Article Snippet: .. The speci c primer sequences were listed below: miR-598, forward, 5 -GCGGUGAUGCCGAUGGUGCGAGC-3 ; and reverse, universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.); U6, forward, 5 -CTCGCTTCGGCAGCACA-3 ; and reverse, 5 - AACGCTTCACGAATTTGCGT-3 ; Ebf1, forward, 5 -AGATTGAGAGGACGGCCTTTGT-3 ; and reverse, 5 - TCTGTCCGTATCCCATTGCTG-3 and β-actin, forward, 5 -CGTGGGCCGCCCTAGGCACCA-3 ; and reverse, 5 -TTGGCCTTAGGGTTCAGGGGG-3 . .. 2.15 western blot Cultured cells or lung tissues were lysed in RIPA buffer with proteinase inhibitor (Beyotime, China).

    Article Title: Palmitic acid inhibits vascular smooth muscle cell switch to synthetic phenotype via upregulation of miR-22 expression
    Article Snippet: R: Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.) miR-125b .. R: Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.) NET1 ..

    Article Title: Hypoxic BMSC-derived exosomal miR-652-3p promotes proliferation and metastasis of hepatocarcinoma cancer cells via targeting TNRC6A
    Article Snippet: .. miR-652-3p , AATGGCGCCACTAGGGTTGTG , Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.). ..

    Article Title: Exosome-delivered miR-153 from Trichinella spiralis promotes apoptosis of intestinal epithelial cells by downregulating Bcl2
    Article Snippet: .. The forward primer sequences for each detected miRNA were obtained from the established miRNA library (Table ), and the universal PCR reverse primer was purchased from Sangon Biotech (China). .. Total miRNA was extracted from the exosomes using the Total RNA Extraction kit (Solarbio, China).

    Article Title: Nicotine-induced miR-21-3p promotes chemoresistance in lung cancer by negatively regulating FOXO3a
    Article Snippet: .. The primer sequences used for qPCR were as follows: miR-21-3p forward, 5′-GCAACACCAGTCGATGGGCTGT-3′ with a Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.); U6 forward, 5′-CTCGCTTCGGCAGCACA-3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′; FOXO3a forward, 5′-ACAAACGGCTCACTCTGTCC-3′ and reverse, 5′-CAGTTCCCTCATTCTGGACCC-3′; protocadherin 19 (PCDH19) forward, 5′-ACTCTTTCAACAGCCAGGGG-3′ and reverse, 5′-TGAAGGTGGAGCTGCTCTTG-3′; ATPase Na+/K+ transporting subunit β1 (ATP1B1) forward, 5′-TGGCATCTTCATCGGAACCAT-3′ and reverse, 5′-ATCTGTCTTAATCCTGGCGG-3′; and β-actin forward, 5′-GCTCCGGCATGTGCAA-3′ and reverse, 5′-GCTCATTGTAGAAAGTGTGGTG-3′. .. All the primers were designed and synthesized by Sangon Biotech Co., Ltd.

    Real-time Polymerase Chain Reaction:

    Article Title: Nicotine-induced miR-21-3p promotes chemoresistance in lung cancer by negatively regulating FOXO3a
    Article Snippet: .. The primer sequences used for qPCR were as follows: miR-21-3p forward, 5′-GCAACACCAGTCGATGGGCTGT-3′ with a Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.); U6 forward, 5′-CTCGCTTCGGCAGCACA-3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′; FOXO3a forward, 5′-ACAAACGGCTCACTCTGTCC-3′ and reverse, 5′-CAGTTCCCTCATTCTGGACCC-3′; protocadherin 19 (PCDH19) forward, 5′-ACTCTTTCAACAGCCAGGGG-3′ and reverse, 5′-TGAAGGTGGAGCTGCTCTTG-3′; ATPase Na+/K+ transporting subunit β1 (ATP1B1) forward, 5′-TGGCATCTTCATCGGAACCAT-3′ and reverse, 5′-ATCTGTCTTAATCCTGGCGG-3′; and β-actin forward, 5′-GCTCCGGCATGTGCAA-3′ and reverse, 5′-GCTCATTGTAGAAAGTGTGGTG-3′. .. All the primers were designed and synthesized by Sangon Biotech Co., Ltd.



    Similar Products

    universal reverse pcr primer  (Servicebio Inc)
    86
    Servicebio Inc universal reverse pcr primer
    Universal Reverse Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/universal+pcr+reverse+primer/pcr+primer+reverse+universal/pmc13145395-9-2-7
    Average 86 stars, based on 1 article reviews
    universal reverse pcr primer - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    universal pcr reverse primer  (Norgen Biotek)
    90
    Norgen Biotek universal pcr reverse primer
    Male-enriched miRNAs regulated fatty acid synthesis-related genes. A and B. EMA-Plot representing the significant biological processes identified by Gene Ontology term analysis in male-enriched miRNAs ( A ) and female-enriched miRNAs ( B ). The genes and corresponding miRNAs targeting these processes are listed in Table S3. C Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of differentially expressed miRNAs enriched in male versus female microglia. The log p-values of the top 10 pathways are shown. The full pathway list is provided in Supplementary Table S5. Significance was calculated using MirPath’s Fisher meta-analysis method. D Quantitative <t>PCR</t> <t>(qPCR)</t> analyses of genes related to fatty acid synthesis and metabolism. Each column represents the mean ± SD of n = 2 samples per sex, each containing pooled hippocampal microglia from five mice. *p < 0.05 versus the corresponding value for females according to Student’s t -test
    Universal Pcr Reverse Primer, supplied by Norgen Biotek, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/universal+pcr+reverse+primer/universal+pcr+reverse+primer/pmc11792555-77-24-27
    Average 90 stars, based on 1 article reviews
    universal pcr reverse primer - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    universal pcr reverse primer  (Applied Biological Materials Inc)
    90
    Applied Biological Materials Inc universal pcr reverse primer
    Male-enriched miRNAs regulated fatty acid synthesis-related genes. A and B. EMA-Plot representing the significant biological processes identified by Gene Ontology term analysis in male-enriched miRNAs ( A ) and female-enriched miRNAs ( B ). The genes and corresponding miRNAs targeting these processes are listed in Table S3. C Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of differentially expressed miRNAs enriched in male versus female microglia. The log p-values of the top 10 pathways are shown. The full pathway list is provided in Supplementary Table S5. Significance was calculated using MirPath’s Fisher meta-analysis method. D Quantitative <t>PCR</t> <t>(qPCR)</t> analyses of genes related to fatty acid synthesis and metabolism. Each column represents the mean ± SD of n = 2 samples per sex, each containing pooled hippocampal microglia from five mice. *p < 0.05 versus the corresponding value for females according to Student’s t -test
    Universal Pcr Reverse Primer, supplied by Applied Biological Materials Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/universal+pcr+reverse+primer/universal+pcr+reverse+primer/pm38277203__ac3c05619_si_001-85-2-9
    Average 90 stars, based on 1 article reviews
    universal pcr reverse primer - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    universal pcr reverse primer  (Sangon Biotech)
    90
    Sangon Biotech universal pcr reverse primer
    <t>MiR-652-3p</t> is upregulated in hyoxic BMSCs-derived exosome and can be transferred to HCC cells. ( A ) Transmission electron microscopy (TMB) showed the representative image of BMSCs or hypo-BMSCs derived exosome. ( B ) The particle diameter of the purified exosomes was showed in histogram. ( C ) Exosomal markers were detected by West blotting in BMSCs derived exosome and BMSCs cells. ( D ) Expression of miR-652-3p was detected in exosome derived from BMSCs under different conditions using <t>qRT-PCR.</t> Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01, compared with the indicated controls. ( E ) Expression of miR-652-3p was detected in HepG2 and SMMC-7721 cells after co-culturing with exosome derived from BMSCs under different conditions. Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05; ** P < 0.01, compared with the indicated controls.
    Universal Pcr Reverse Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/universal+pcr+reverse+primer/mirna+first+strand+cdna+synthesis+kit/pmc10713425-2-4-11
    Average 90 stars, based on 1 article reviews
    universal pcr reverse primer - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    universal pcr reverse primer b532451  (Sangon Biotech)
    90
    Sangon Biotech universal pcr reverse primer b532451
    <t>MiR-652-3p</t> is upregulated in hyoxic BMSCs-derived exosome and can be transferred to HCC cells. ( A ) Transmission electron microscopy (TMB) showed the representative image of BMSCs or hypo-BMSCs derived exosome. ( B ) The particle diameter of the purified exosomes was showed in histogram. ( C ) Exosomal markers were detected by West blotting in BMSCs derived exosome and BMSCs cells. ( D ) Expression of miR-652-3p was detected in exosome derived from BMSCs under different conditions using <t>qRT-PCR.</t> Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01, compared with the indicated controls. ( E ) Expression of miR-652-3p was detected in HepG2 and SMMC-7721 cells after co-culturing with exosome derived from BMSCs under different conditions. Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05; ** P < 0.01, compared with the indicated controls.
    Universal Pcr Reverse Primer B532451, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/universal+pcr+reverse+primer/mirna+first+strand+cdna+synthesis+kit/pmc09614396__kjpp___26___6___519___supple-2-34-43
    Average 90 stars, based on 1 article reviews
    universal pcr reverse primer b532451 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Male-enriched miRNAs regulated fatty acid synthesis-related genes. A and B. EMA-Plot representing the significant biological processes identified by Gene Ontology term analysis in male-enriched miRNAs ( A ) and female-enriched miRNAs ( B ). The genes and corresponding miRNAs targeting these processes are listed in Table S3. C Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of differentially expressed miRNAs enriched in male versus female microglia. The log p-values of the top 10 pathways are shown. The full pathway list is provided in Supplementary Table S5. Significance was calculated using MirPath’s Fisher meta-analysis method. D Quantitative PCR (qPCR) analyses of genes related to fatty acid synthesis and metabolism. Each column represents the mean ± SD of n = 2 samples per sex, each containing pooled hippocampal microglia from five mice. *p < 0.05 versus the corresponding value for females according to Student’s t -test

    Journal: Biology of Sex Differences

    Article Title: Sex differences in the neuroinflammatory signaling pathway: effect of miRNAs on fatty acid synthesis in microglia

    doi: 10.1186/s13293-025-00686-8

    Figure Lengend Snippet: Male-enriched miRNAs regulated fatty acid synthesis-related genes. A and B. EMA-Plot representing the significant biological processes identified by Gene Ontology term analysis in male-enriched miRNAs ( A ) and female-enriched miRNAs ( B ). The genes and corresponding miRNAs targeting these processes are listed in Table S3. C Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of differentially expressed miRNAs enriched in male versus female microglia. The log p-values of the top 10 pathways are shown. The full pathway list is provided in Supplementary Table S5. Significance was calculated using MirPath’s Fisher meta-analysis method. D Quantitative PCR (qPCR) analyses of genes related to fatty acid synthesis and metabolism. Each column represents the mean ± SD of n = 2 samples per sex, each containing pooled hippocampal microglia from five mice. *p < 0.05 versus the corresponding value for females according to Student’s t -test

    Article Snippet: The abundance of miRNA was quantified through quantitative PCR (qPCR) using THUNDERBIRD Next SYBR qPCR Mix (Toyobo, Osaka, Japan), in conjunction with the universal PCR reverse primer (Norgen Biotek Corp.) and a specific forward primer designed from the whole sequence of the miRNAs of interest.

    Techniques: Real-time Polymerase Chain Reaction

    MiR-652-3p is upregulated in hyoxic BMSCs-derived exosome and can be transferred to HCC cells. ( A ) Transmission electron microscopy (TMB) showed the representative image of BMSCs or hypo-BMSCs derived exosome. ( B ) The particle diameter of the purified exosomes was showed in histogram. ( C ) Exosomal markers were detected by West blotting in BMSCs derived exosome and BMSCs cells. ( D ) Expression of miR-652-3p was detected in exosome derived from BMSCs under different conditions using qRT-PCR. Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01, compared with the indicated controls. ( E ) Expression of miR-652-3p was detected in HepG2 and SMMC-7721 cells after co-culturing with exosome derived from BMSCs under different conditions. Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05; ** P < 0.01, compared with the indicated controls.

    Journal: Aging (Albany NY)

    Article Title: Hypoxic BMSC-derived exosomal miR-652-3p promotes proliferation and metastasis of hepatocarcinoma cancer cells via targeting TNRC6A

    doi: 10.18632/aging.205025

    Figure Lengend Snippet: MiR-652-3p is upregulated in hyoxic BMSCs-derived exosome and can be transferred to HCC cells. ( A ) Transmission electron microscopy (TMB) showed the representative image of BMSCs or hypo-BMSCs derived exosome. ( B ) The particle diameter of the purified exosomes was showed in histogram. ( C ) Exosomal markers were detected by West blotting in BMSCs derived exosome and BMSCs cells. ( D ) Expression of miR-652-3p was detected in exosome derived from BMSCs under different conditions using qRT-PCR. Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01, compared with the indicated controls. ( E ) Expression of miR-652-3p was detected in HepG2 and SMMC-7721 cells after co-culturing with exosome derived from BMSCs under different conditions. Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05; ** P < 0.01, compared with the indicated controls.

    Article Snippet: miR-652-3p , AATGGCGCCACTAGGGTTGTG , Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.).

    Techniques: Derivative Assay, Transmission Assay, Electron Microscopy, Purification, Expressing, Quantitative RT-PCR

    TNRC6A is a direct target of miR-652-3p in human HCC cells. ( A ) The underlying targets of miR-652-3p were predicted using TargetScan and miRDB databases. ( B ) Expression of target genes in HepG2 cells determined by qRT-PCR after transfecting with miR-652-3p mimic. ( C ) Scheme and sequence of the intact miR-652-3p, TNRC6A (Wt) and its mutant (Mut). Computer prediction of miR-652-3p binding sites in the 3’UTR of human TNRC6A gene. ( D ) SMMC-7721 cells were co-transfected with miR-652-3p and WT or MUT 3’UTR of TNRC6A. Data were presented as the mean ± SD, and analyzed with Student’s t-test. ** < 0.01; compared with the indicated NC mimic controls. ( E ) Protein level of TNRC6A was detected by WB in HepG2 and SMMC-7721 cells transfected with NC mimic and miR-652-3p. GAPDH was also detected as a loading control. Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01.

    Journal: Aging (Albany NY)

    Article Title: Hypoxic BMSC-derived exosomal miR-652-3p promotes proliferation and metastasis of hepatocarcinoma cancer cells via targeting TNRC6A

    doi: 10.18632/aging.205025

    Figure Lengend Snippet: TNRC6A is a direct target of miR-652-3p in human HCC cells. ( A ) The underlying targets of miR-652-3p were predicted using TargetScan and miRDB databases. ( B ) Expression of target genes in HepG2 cells determined by qRT-PCR after transfecting with miR-652-3p mimic. ( C ) Scheme and sequence of the intact miR-652-3p, TNRC6A (Wt) and its mutant (Mut). Computer prediction of miR-652-3p binding sites in the 3’UTR of human TNRC6A gene. ( D ) SMMC-7721 cells were co-transfected with miR-652-3p and WT or MUT 3’UTR of TNRC6A. Data were presented as the mean ± SD, and analyzed with Student’s t-test. ** < 0.01; compared with the indicated NC mimic controls. ( E ) Protein level of TNRC6A was detected by WB in HepG2 and SMMC-7721 cells transfected with NC mimic and miR-652-3p. GAPDH was also detected as a loading control. Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01.

    Article Snippet: miR-652-3p , AATGGCGCCACTAGGGTTGTG , Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.).

    Techniques: Expressing, Quantitative RT-PCR, Sequencing, Mutagenesis, Binding Assay, Transfection, Control

    Overexpression of miR-652-3p aborted the inhibitive effects of TNRC6A on the proliferation and metastasis of HCC cells. ( A ) The expression of miR-652-3p inHepG2 and SMMC-7721 cells determined by qRT-PCR, Cells were treated with four different means: pcDNA3.1 group, pcDNA3.1-TNRC6A group, co-transfection pcDNA3.1-TNRC6A and NC mimics and co-transfection pcDNA3.1-TNRC6A and miR-652-3p mimic group. Data were presented as the mean ± SD, and analyzed with Student’s t-test *** P < 0.001 ( B ) The mRNA expression of TNRC6A in HepG2 and SMMC-7721 cells determined by qRT-PCR. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01. ( C ) The protein expression of TNRC6A in HepG2 and SMMC-7721 cells determined by WB. Histogram show the protein expression of TNRC6A in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; **P < 0.01, ***P < 0.001. ( D ) Proliferation of HepG2 and SMMC-7721 cells determined by CCK-8 after treating with different ways, Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05 *** P < 0.001. ( E ) Colony formation assay of HepG2 and SMMC-7721 cells after treating with different ways ( F ) Histogram show the amount of colony in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01 *** P < 0.001. ( G ) Histogram show the distance of cellular migratory in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01. ( H ) Migration of HepG2 and SMMC-7721 cells determined by wound healing. ( I ) Invasion of HepG2 and SMMC-7721 cells determined by transwell. Cells that invaded to the bottom surface were stained with crystal violet and observed by light microscopy (magnification, 100×). Histogram show the capability of cellular invasion in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01 *** P < 0.001.

    Journal: Aging (Albany NY)

    Article Title: Hypoxic BMSC-derived exosomal miR-652-3p promotes proliferation and metastasis of hepatocarcinoma cancer cells via targeting TNRC6A

    doi: 10.18632/aging.205025

    Figure Lengend Snippet: Overexpression of miR-652-3p aborted the inhibitive effects of TNRC6A on the proliferation and metastasis of HCC cells. ( A ) The expression of miR-652-3p inHepG2 and SMMC-7721 cells determined by qRT-PCR, Cells were treated with four different means: pcDNA3.1 group, pcDNA3.1-TNRC6A group, co-transfection pcDNA3.1-TNRC6A and NC mimics and co-transfection pcDNA3.1-TNRC6A and miR-652-3p mimic group. Data were presented as the mean ± SD, and analyzed with Student’s t-test *** P < 0.001 ( B ) The mRNA expression of TNRC6A in HepG2 and SMMC-7721 cells determined by qRT-PCR. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01. ( C ) The protein expression of TNRC6A in HepG2 and SMMC-7721 cells determined by WB. Histogram show the protein expression of TNRC6A in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; **P < 0.01, ***P < 0.001. ( D ) Proliferation of HepG2 and SMMC-7721 cells determined by CCK-8 after treating with different ways, Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05 *** P < 0.001. ( E ) Colony formation assay of HepG2 and SMMC-7721 cells after treating with different ways ( F ) Histogram show the amount of colony in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01 *** P < 0.001. ( G ) Histogram show the distance of cellular migratory in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01. ( H ) Migration of HepG2 and SMMC-7721 cells determined by wound healing. ( I ) Invasion of HepG2 and SMMC-7721 cells determined by transwell. Cells that invaded to the bottom surface were stained with crystal violet and observed by light microscopy (magnification, 100×). Histogram show the capability of cellular invasion in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01 *** P < 0.001.

    Article Snippet: miR-652-3p , AATGGCGCCACTAGGGTTGTG , Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.).

    Techniques: Over Expression, Expressing, Quantitative RT-PCR, Cotransfection, CCK-8 Assay, Colony Assay, Migration, Staining, Light Microscopy

    Primers for qRT-PCR.

    Journal: Aging (Albany NY)

    Article Title: Hypoxic BMSC-derived exosomal miR-652-3p promotes proliferation and metastasis of hepatocarcinoma cancer cells via targeting TNRC6A

    doi: 10.18632/aging.205025

    Figure Lengend Snippet: Primers for qRT-PCR.

    Article Snippet: miR-652-3p , AATGGCGCCACTAGGGTTGTG , Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.).

    Techniques: